View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19809_low_4 (Length: 249)
Name: NF19809_low_4
Description: NF19809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19809_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 40358577 - 40358358
Alignment:
| Q |
18 |
agtatcgtgttcagtgtcattgtttcgtagatttgaacttcaaagtttctcaaagaaataattaacgcatttcaaacacatcttgtcaagatggactaga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
40358577 |
agtatcgtgttcagtgtcattgtttcgtagatttgaacttcaaagtttctcaaagaaatcattaatgcatttcaaacacatct-----------actaga |
40358489 |
T |
 |
| Q |
118 |
aataaatctaagggattctatatttagtataggatgtagttagtatttttgttttgtataagggtgnnnnnnnnnnnacagattgggaaagggacttata |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
40358488 |
aataaatctaagggattctatatttaggataggatgtagttagtatttttgttttgaataagggtgtttttgtttttacagattgggaaagggacttata |
40358389 |
T |
 |
| Q |
218 |
gcaatgtgtacaaagctaaagaccttgttac |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40358388 |
gcaatgtgtacaaagctaaagaccttgttac |
40358358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University