View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1980_low_3 (Length: 247)
Name: NF1980_low_3
Description: NF1980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1980_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 33034258 - 33034057
Alignment:
| Q |
17 |
atcatctccttatcttaaagcttttcttgccatgtttttgtcaccactaaagtagtttcatctctaaactattccaagtaagtttttctt-gcgtttgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33034258 |
atcatctccttatcttaaagcttttcttgccatgtttttgtcaccactaaagtagtttcatctctaaactattccaagtaagtttttctttgcgtttgtt |
33034159 |
T |
 |
| Q |
116 |
ttcttagaatgaaaatctttgtagattttaatgaaacaagcatctgcatgcacttctttgtttttggatactttgatgttgttagttctctatattaatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33034158 |
ttcttagaatgaaaatctttgtagattttaatgaaacaagtatctgcatgcacttctttgtttttggatactttgatgttgttagttctctatattaatg |
33034059 |
T |
 |
| Q |
216 |
tt |
217 |
Q |
| |
|
|| |
|
|
| T |
33034058 |
tt |
33034057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University