View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19810_high_8 (Length: 219)
Name: NF19810_high_8
Description: NF19810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19810_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 50834412 - 50834610
Alignment:
| Q |
1 |
ccctattcttcttctgatcttcaacacacaaaaacccttcttcttatgccctcacttggggaatgaatttgctttctcggtttgtaagaacaagaggtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50834412 |
ccctattcttcttctgatcttcaacacacaaaaacccttcttcttatgccctcacttggggaatgaatttgctttctcggtttgtaagaacaagaggtgt |
50834511 |
T |
 |
| Q |
101 |
gtaatttcttcatttggagttttgaatgtcttttattgactttgcattagtgttgagctttgcttttgatcatcaatcccgtctttccatgggcatatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50834512 |
gtaatttcttcatttggagttttgaatgtcttttattgactttgcattagtgttgagctttgcttttgatcatcaatcccgtctttccatgggcatatt |
50834610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 50841441 - 50841243
Alignment:
| Q |
1 |
ccctattcttcttctgatcttcaacacacaaaaacccttcttcttatgccctcacttggggaatgaatttgctttctcggtttgtaagaacaagaggtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50841441 |
ccctattcttcttctgatcttcaacacacaaaaacccttcttcttatgccctcacttggggaatgaatttgctttctcggtttgtaagaacaagaggtgt |
50841342 |
T |
 |
| Q |
101 |
gtaatttcttcatttggagttttgaatgtcttttattgactttgcattagtgttgagctttgcttttgatcatcaatcccgtctttccatgggcatatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50841341 |
gtaatttcttcatttggagttttgaatgtcttttattgactttgcattagtgttgagctttgcttttgatcatcaatcccgtctttccatgggcatatt |
50841243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 54
Target Start/End: Complemental strand, 43618697 - 43618669
Alignment:
| Q |
26 |
acacaaaaacccttcttcttatgccctca |
54 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43618697 |
acacaaaaacccttcttcttatgccctca |
43618669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University