View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19810_low_9 (Length: 237)
Name: NF19810_low_9
Description: NF19810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19810_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 27674698 - 27674479
Alignment:
| Q |
1 |
gcttttattttcttacaaatctctgaactattaaatgacaaaatcacnnnnnnnn-ctataatctatagtaaatggactcttagtctctctttgaagttt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27674698 |
gcttttattttcttacaaatctctgaactattaaatgaaaaaatcactttttttttctataatctatagtaaatggactcttagtctctctttgaagttt |
27674599 |
T |
|
| Q |
100 |
tgctaaattcctttatgcagaacaaatggaaattttaaagcaaagggaaggaaatgaagaaaggctaacatggggagagatacaaaagatgaaatacaca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27674598 |
tgctaaattcctttatgcagaacaaatggaaattttaaagcaaagggaagcaaatgaagaggggctaacatggggagagatacaaaagatgaaatacaca |
27674499 |
T |
|
| Q |
200 |
tggagagttgctcaagaatt |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27674498 |
tggagagttgctcaagaatt |
27674479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 99 - 213
Target Start/End: Original strand, 27671627 - 27671741
Alignment:
| Q |
99 |
ttgctaaattcctttatgcagaacaaatggaaattttaaagcaaagggaaggaaatgaagaaaggctaacatggggagagatacaaaagatgaaatacac |
198 |
Q |
| |
|
||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27671627 |
ttgctaaatacttttatgcagaacaaatggaaatcataaagcaaagggaaggaaatgaagacaggctaacatggggagagatacaaaatatgaaatacac |
27671726 |
T |
|
| Q |
199 |
atggagagttgctca |
213 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27671727 |
atggagagttgctca |
27671741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University