View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19812_high_3 (Length: 249)
Name: NF19812_high_3
Description: NF19812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19812_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 9486799 - 9486587
Alignment:
| Q |
11 |
ccaagaaaatatgggtggtaagaacaaaaatactttgaatgtaacttgaagg-aaatgacaagaaatctcatgctattaactgagatcaggtatactcca |
109 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9486799 |
ccaataaaatatgggtggtaagaacataaatactttgaatgtaacttgaaggaaaatgacaagaaatctcatgctattaac-gagatcaggtatactcca |
9486701 |
T |
 |
| Q |
110 |
tttatctcatgctccatgtagtctatttaaggtcttgaatgaaagacatgtgacnnnnnnnttcaagggttgaagtttaaaaataaattaatatgtgatg |
209 |
Q |
| |
|
||||||||||||||||| ||||| ||||| |||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9486700 |
tttatctcatgctccatttagtccatttagggtc---aatgaaagacat-tgataaaaaaattcaagggttgaagtttaaaaataaattaatatgtgatg |
9486605 |
T |
 |
| Q |
210 |
attttaaaatacagatca |
227 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9486604 |
attttaaaatacagatca |
9486587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University