View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19813_high_20 (Length: 391)
Name: NF19813_high_20
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19813_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 3 - 386
Target Start/End: Original strand, 3981252 - 3981635
Alignment:
| Q |
3 |
caagttagttttgatattcttgacctcagcgggaatgaattgaagagtgacgcttcttttctatttggggagaataaaacaaacactcagatcctcaact |
102 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3981252 |
caagttaattttgatattcttgacctcagcgggaatgaattgaagagtgacgcttcttttctatttggggagaataaaacaaacactcagatcctcaact |
3981351 |
T |
|
| Q |
103 |
tgttgtgcaaccacttgtcgtttgatctgactaacgtggtaatgccggtaggggaagatatcccgatcttgtcgtccttggacttgagctacaatcattt |
202 |
Q |
| |
|
||| |||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3981352 |
tgtcgtgcaatcacttgttgtttgatctgactaacgtggtaatgccggtaggagaagatatcccgatcttgtcatccttggacttgagctacaatcattt |
3981451 |
T |
|
| Q |
203 |
atacaaatggttgccagcttggttaggccaagccccattgttgcaccagtttaatatgtagtgttgttatgagagcatctgagggtgaagttagggggtt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3981452 |
atacaaatggttgccagcttggttaggccaagccccattgttgcaccagtttaatatgtagtgttgttatgagagcatctgagggtgaagttagggggtt |
3981551 |
T |
|
| Q |
303 |
gctccaaggcctcaattggattgtctctttagaatacaatcatttgatctttgaattagattgaaaaatggttattgatgatgt |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3981552 |
gctccaaggcctcaattggattgtctctttagaatacaatcatgtgatctttgaattagattgcaaaatggttattgatgatgt |
3981635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University