View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19813_high_29 (Length: 304)
Name: NF19813_high_29
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19813_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 15 - 236
Target Start/End: Original strand, 42240811 - 42241032
Alignment:
| Q |
15 |
attgcggctggggatgagttaacttgcgactttaacaaccttttgcttgtatgaggttgtgatacttcaattttctgacacggaaaatgctagtgtttac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42240811 |
attgcggctggggatgagttaacttgcgactttaacaaccttttgcttgtatgaggttgtgatacttcaattttctgacatggaaaatgctagtgtttac |
42240910 |
T |
 |
| Q |
115 |
aaaaagattattaacgcaagaatgtcaataaatttgatccatcaatttacagccaaatgcagaattattgtcgtttcaccctttcaaacagttagactta |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42240911 |
aaaatgattattaacgcaagaatgtcaataaatttgatccatcaatttacagccaaatgcagaattattgttgtttcaccctttcaaacagttagactta |
42241010 |
T |
 |
| Q |
215 |
atactattactttatgttgaaa |
236 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42241011 |
atactattactttatgttgaaa |
42241032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University