View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19813_high_37 (Length: 270)
Name: NF19813_high_37
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19813_high_37 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 15 - 270
Target Start/End: Original strand, 38483663 - 38483918
Alignment:
| Q |
15 |
aattatgatgatataaatgagtatttttggagtaagaggtgttttgagaaattgaaatggcctattgatatcgggagtagttttttcgatggaaatcgtg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38483663 |
aattatgatgatataaatgagtatttttggagtaagaggtgttttgagaaattgaaatggcctattgatattgggagtagttttttcgatggaaatcgtg |
38483762 |
T |
|
| Q |
115 |
ttgggaagacaggttttgttgaacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgat |
214 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483763 |
ttgggaagacgggttttgttgaacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgat |
38483862 |
T |
|
| Q |
215 |
tattgttggttggaatgatagagcttatccttggcgtgcggtgatggaggaacgcg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483863 |
tattgttggttggaatgatagagcttatccttggcgtgcggtgatggaggaacgcg |
38483918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 15 - 58
Target Start/End: Original strand, 3682867 - 3682910
Alignment:
| Q |
15 |
aattatgatgatataaatgagtatttttggagtaagaggtgttt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3682867 |
aattatgatgatataaatgagtatttttggagtaggaggtgttt |
3682910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 15 - 207
Target Start/End: Original strand, 30118053 - 30118257
Alignment:
| Q |
15 |
aattatgatgatataaatgagtatttttggagtaagaggtgttttgagaaattgaaatggcctattgatatcgggagtagtttttt------------cg |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||||||||| |||| | ||||||| |||||| |
|
|
| T |
30118053 |
aattatgatgatattaatgagtatttttggagtaggaggtgttttgagaagatgaaatggcctcctgatgttgggagtaatttttttactactgttggta |
30118152 |
T |
|
| Q |
103 |
atggaaatcgtgttgggaagacaggttttgttgaacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttct |
202 |
Q |
| |
|
| || || | |||||| ||||| || |||||||| | ||| |||||||||||| ||||| |||||||||| ||||||||| | |||||| | |||||||| |
|
|
| T |
30118153 |
aggggaaacatgttggtaagaccggatttgttgagcagagatcgttttggaatctgtttcggagttttgacaggctttggattatgttggtgttgtttct |
30118252 |
T |
|
| Q |
203 |
tcaag |
207 |
Q |
| |
|
||||| |
|
|
| T |
30118253 |
tcaag |
30118257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University