View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19813_high_40 (Length: 255)
Name: NF19813_high_40
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19813_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 47875857 - 47876084
Alignment:
| Q |
17 |
cagaagactatcagtttgaaatgaatactgcatattactgcattgcaaggacttctgtaaggagtagctgtaagtcagaatgatggaaagatataattca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47875857 |
cagaagactatcagtttgaaatgaatactgcatattactgcattgcaaggacttctgtaaggagtagttgtaagtcagaatgatggaaagatataattca |
47875956 |
T |
 |
| Q |
117 |
acctccaagtgggagagacagaatgatcagttaagtcgtgccccgtaannnnnnnngaagcagcactgtgcggtcttcaacgagcggagaggggggtaac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47875957 |
acctccaagtgggagagacagaatgatcagttaagtcgtgccccgtaaatttttttcaagcagcactgtgcggtcttcaacgagcggagaggggggtaac |
47876056 |
T |
 |
| Q |
217 |
ttgagaaaactagaaagtgaccgttcat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
47876057 |
ttgagaaaactagaaagtgaccgttcat |
47876084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University