View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19813_high_49 (Length: 224)
Name: NF19813_high_49
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19813_high_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 52592978 - 52592866
Alignment:
| Q |
1 |
acccggatttgaataaatgataaccaaacagggaacaatccattatacaaataaattatgttcttatatgcttgaaatgctttgttttttatggttgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52592978 |
acccggatttgaataaatgataaccaaacagggaacaatccattatacaaataaattctgttcttacatgcttgaaatgctttgttttttatggttgaaa |
52592879 |
T |
 |
| Q |
101 |
ttacactggtcac |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52592878 |
ttacactggtcac |
52592866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University