View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19813_high_50 (Length: 206)
Name: NF19813_high_50
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19813_high_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 12 - 192
Target Start/End: Complemental strand, 49994233 - 49994053
Alignment:
| Q |
12 |
catcatcaaacccccaaactcttcccaccaccactcccacaagactcaccaccatacnnnnnnnnnnnnncaacttaaatttccattcaacattgtctga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
49994233 |
catcatcaaacccccaaactcttcccaccaccactcccacaagactcaccaccatacaaaaagtaaaaaacaacttaaatttccattcaacattatctga |
49994134 |
T |
|
| Q |
112 |
actcaatggagccatgggtgaccttggcacatacataccaatagtactttcgctcaccctttccaaaaacctcaaccttgg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49994133 |
actcaatggagccatgggtgaccttggcacatacataccaatagtactttcactcaccctttccaaaaacctcaaccttgg |
49994053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 91 - 156
Target Start/End: Complemental strand, 25800093 - 25800028
Alignment:
| Q |
91 |
tttccattcaacattgtctgaactcaatggagccatgggtgaccttggcacatacataccaatagt |
156 |
Q |
| |
|
||||||||||| || | ||||| | ||||| |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
25800093 |
tttccattcaaaatgggctgaattaaatggtgccatgggtgaccttggcacctacatacccatagt |
25800028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 95 - 162
Target Start/End: Original strand, 1874599 - 1874666
Alignment:
| Q |
95 |
cattcaacattgtctgaactcaatggagccatgggtgaccttggcacatacataccaatagtactttc |
162 |
Q |
| |
|
||||||| || | ||||||| ||||| |||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
1874599 |
cattcaaaatgggctgaactaaatggtgccatgggtgaccttggcacctacataccaatagttctttc |
1874666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University