View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19813_low_32 (Length: 335)
Name: NF19813_low_32
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19813_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 35725158 - 35724835
Alignment:
| Q |
1 |
gttgtgaattctgattactccttagtccttcctagggcagtgacaagcaattccccgtcgtggaaatttcaagtgctctttagtttcagagaagaagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35725158 |
gttgtgaattctgattactccttagtccttcctagggcagtgacaagcaattccccgtcgtggaaatttcaagtgctctttagtttcagagaagaagaaa |
35725059 |
T |
|
| Q |
101 |
cttgcaacaaattcactgatcacctctacacaacatttaaaggaagtggcttaaccgttttcacagacgacaaaaaacttcagagaggggaagttttctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35725058 |
cttgcaacaaattcactgatcacctctacacaacatttaaaggaagtggcttaaccgttttcacagacgacaaaaaacttcagagaggggaagttttctg |
35724959 |
T |
|
| Q |
201 |
tcatggtggttctgtctcctgactccacttctttgcggtggtgcttgtatgagctactttacatcct--------aaatccaatccagtcattatgtttg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || || ||||||||| |
|
|
| T |
35724958 |
tcatggtggttctgtctcctgactccacttctttgcggtggtgcttgtatgagctactttacatcctctgatttcaaatccaattcattcgttatgtttg |
35724859 |
T |
|
| Q |
293 |
ccctgtcttctacgatgtggatcc |
316 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35724858 |
ccctgtcttctacgatgtggatcc |
35724835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 26 - 188
Target Start/End: Original strand, 35683652 - 35683814
Alignment:
| Q |
26 |
tccttcctagggcagtgacaagcaattccccgtcgtggaaatttcaagtgctctttagtttcagagaagaagaaacttgcaacaaattcactgatcacct |
125 |
Q |
| |
|
||||| ||| ||||||||| | || ||| || || ||||||||||| ||| |||| |||||||||| || ||||||| | ||||||||||| |||||||| |
|
|
| T |
35683652 |
tcctttctatggcagtgactaacacttctccatcatggaaatttcacgtgttcttgagtttcagaggagtagaaactcgaaacaaattcaccgatcacct |
35683751 |
T |
|
| Q |
126 |
ctacacaacatttaaaggaagtggcttaaccgttttcacagacgacaaaaaacttcagagagg |
188 |
Q |
| |
|
|||| || | |||| ||| |||||||| ||||||| ||||||| | | ||||||||||| |
|
|
| T |
35683752 |
ctacgcagcgtttatcagaaccggcttaacagttttcaaggacgacacagagcttcagagagg |
35683814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University