View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19813_low_35 (Length: 312)
Name: NF19813_low_35
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19813_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 3088736 - 3089015
Alignment:
| Q |
18 |
cttcgtaggatctcgatcctgattatattggatgatatgtcnnnnnnngataattaatatgctcattggatccatgccacgtatcttacatagcccttgt |
117 |
Q |
| |
|
||||||||| |||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088736 |
cttcgtaggttctcgatcctgactatattg-atgatatgtcaaaaaaagataattaatatgctcattggatccatgccacgtatcttacatagcccttgt |
3088834 |
T |
 |
| Q |
118 |
tgctgtcatatatggaagatcacggtggtccattttatatttttcaatatctcaaaattgctgagcttctagaaggggtatgtatatttttattaagcag |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088835 |
tgctgtcatatatggaagatcatggtggtccattttatatttttcaatatctcaaaattgctgagcttctagaaggggtatgtatatttttattaagcag |
3088934 |
T |
 |
| Q |
218 |
agcttctagaagagtgatctagcaatgcatgctatccatttgtacaaaaacagtattaaaagcaaaagaatcttgcaaacc |
298 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3088935 |
agcttctagaagagtgatctagtaatgcatgctatccatttgtacaaaaatagtattaaaagcaaaagaatcttgcaaacc |
3089015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University