View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19813_low_36 (Length: 304)

Name: NF19813_low_36
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19813_low_36
NF19813_low_36
[»] chr4 (1 HSPs)
chr4 (15-236)||(42240811-42241032)


Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 15 - 236
Target Start/End: Original strand, 42240811 - 42241032
Alignment:
15 attgcggctggggatgagttaacttgcgactttaacaaccttttgcttgtatgaggttgtgatacttcaattttctgacacggaaaatgctagtgtttac 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
42240811 attgcggctggggatgagttaacttgcgactttaacaaccttttgcttgtatgaggttgtgatacttcaattttctgacatggaaaatgctagtgtttac 42240910  T
115 aaaaagattattaacgcaagaatgtcaataaatttgatccatcaatttacagccaaatgcagaattattgtcgtttcaccctttcaaacagttagactta 214  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
42240911 aaaatgattattaacgcaagaatgtcaataaatttgatccatcaatttacagccaaatgcagaattattgttgtttcaccctttcaaacagttagactta 42241010  T
215 atactattactttatgttgaaa 236  Q
    ||||||||||||||||||||||    
42241011 atactattactttatgttgaaa 42241032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University