View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19813_low_39 (Length: 288)
Name: NF19813_low_39
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19813_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 4495982 - 4496251
Alignment:
| Q |
1 |
atttatatgcatggtaaagggaaaggtcaatggtcataatcataattccacagtggaataatgctaaggatggnnnnnnnn--tggaatgttagtgagtt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4495982 |
atttatatgcatggtaaagggaaaggtcaatggtcataatcacaattccatagttgaataatgctaaggatggaaaaaaaaaatggaatgttagtgagtt |
4496081 |
T |
 |
| Q |
99 |
tgtgagaatggtcatgctgttagtattaaccagcaatttaagtatcttaattgaaatgtcaacttggaaggctcagataattttttgagtactatattgg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4496082 |
tgtgagaatggtcatgctgttagtattaaccagcaatttaagtatcttaattgaaatgtcaacttggaaggctcggataattttttgagtactatattgg |
4496181 |
T |
 |
| Q |
199 |
tccaaatagtagagaagtggtccccaaacaatgatatttaggatcttacattcggtccaaaaagatagtt |
268 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4496182 |
tccaactagtagagaagtggtccccaaacaatgatatttaggatcttacatgcggtccaaaaagatagtt |
4496251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University