View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19813_low_53 (Length: 237)
Name: NF19813_low_53
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19813_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 141 - 222
Target Start/End: Original strand, 11839948 - 11840029
Alignment:
| Q |
141 |
ttactcaaccttctctaatttggttcaaaactgaactgaattgatttagttcgatttttgttattcattttgatatccattg |
222 |
Q |
| |
|
|||||| |||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11839948 |
ttactcgaccttctctagtttggtttaaaactgaactgaattgatttagtttgatttttgttattcattttgatatccattg |
11840029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 100
Target Start/End: Original strand, 11839875 - 11839907
Alignment:
| Q |
68 |
aactgattggatcaaggggtgtgactgattaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
11839875 |
aactgattggatcaaggggtgtgactgtttaag |
11839907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University