View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19813_low_53 (Length: 237)

Name: NF19813_low_53
Description: NF19813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19813_low_53
NF19813_low_53
[»] chr1 (2 HSPs)
chr1 (141-222)||(11839948-11840029)
chr1 (68-100)||(11839875-11839907)


Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 141 - 222
Target Start/End: Original strand, 11839948 - 11840029
Alignment:
141 ttactcaaccttctctaatttggttcaaaactgaactgaattgatttagttcgatttttgttattcattttgatatccattg 222  Q
    |||||| |||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
11839948 ttactcgaccttctctagtttggtttaaaactgaactgaattgatttagtttgatttttgttattcattttgatatccattg 11840029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 100
Target Start/End: Original strand, 11839875 - 11839907
Alignment:
68 aactgattggatcaaggggtgtgactgattaag 100  Q
    ||||||||||||||||||||||||||| |||||    
11839875 aactgattggatcaaggggtgtgactgtttaag 11839907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University