View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19814_high_12 (Length: 207)
Name: NF19814_high_12
Description: NF19814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19814_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 4409920 - 4410050
Alignment:
| Q |
1 |
gatttatttaaggttcctatgcttattaagacaaggttggttcatttgtttttgcttacaaaca-nnnnnnnnaactgtagccttatcttaaaattgttc |
99 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4409920 |
gatttatgtaaggttcctatgcttattaagacaaggttggttcatttgtttttgcttacaaacatttttttttaactgtagccttatcttaaaattgttc |
4410019 |
T |
 |
| Q |
100 |
ttgttatcaaataagtaagtagtcaaaaatc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4410020 |
ttgttatcaaataagtaagtagtcaaaaatc |
4410050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University