View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19814_high_6 (Length: 347)
Name: NF19814_high_6
Description: NF19814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19814_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 20 - 321
Target Start/End: Original strand, 23617246 - 23617547
Alignment:
| Q |
20 |
accacaaccacaaagtcatgaaataagctattaccctcaaaatccaaaagtgcttctacctgcagtaggttatagaaggaaccatgctgagaaagttatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23617246 |
accacaaccacaaagtcatgaaataagctattaccctcaaaatccaaaagtgcttctacctgcagtaggttatagaaggaaccatgctgagaaagttatg |
23617345 |
T |
 |
| Q |
120 |
tcaaactcaaatggcatgtcaaatatctgcaatagtccaatggtatataatgaaaacatgcaacagagaatccctaaccctaattatgactttggttaca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23617346 |
tcaaactcaaatggcatgtcaaatatctgcaatagtccaatggtatataatgaaaacatgcaacagagaatcctaaaccctaattatgactttggttaca |
23617445 |
T |
 |
| Q |
220 |
gtaatcaagaaacattggatttgtttccactgcatccaactggcatattggaagggaaatcaactgaccaggtgtcttctagtgtttcagtttcagctga |
319 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
23617446 |
gtaatcaagaaacattggatttgtttcctctgcatccaactggcatattggaagggaaatcaactgaccaggtgtcttctattgtttcagtttctgctga |
23617545 |
T |
 |
| Q |
320 |
ta |
321 |
Q |
| |
|
|| |
|
|
| T |
23617546 |
ta |
23617547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University