View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19814_low_13 (Length: 235)
Name: NF19814_low_13
Description: NF19814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19814_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 6722183 - 6721966
Alignment:
| Q |
1 |
tgatagtgtacgatagattgaggcaattagtgaattgtgacatttgcgtcgccgatcgtgaatgtattacaaatgtaacttatgaccacatctttcaagg |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| || ||||| ||||| |||||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
6722183 |
tgatattgtacgatagattgaggcaattagtgaactgtaacgtttgcctcgccaatcgtgaatgcattacaaatggaacttatgaccacatctctcaaga |
6722084 |
T |
 |
| Q |
101 |
cgaatcctccttctttagcacttacgtgaacgtcctatcttacttgattcttcgacatccaaagagaagggatcattaataaatgatctacaacacttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6722083 |
cgaatcctccttctttagcacttacgtgaacgtcctatcttacttgattcttcgacatccatagagaagggatcattaataaatgatctacaacacttgt |
6721984 |
T |
 |
| Q |
201 |
t-atacgtgacctcaact |
217 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
6721983 |
tgttacgtgacctcaact |
6721966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University