View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19814_low_3 (Length: 618)
Name: NF19814_low_3
Description: NF19814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19814_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 380 - 603
Target Start/End: Original strand, 29769824 - 29770047
Alignment:
| Q |
380 |
agattgtgttttctttattgtgattgctacggaactaaactcaacaaaaaagtttttgtgattttaatgataaagttgttagttactatctttgtgtggt |
479 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29769824 |
agattgtgttttctttattgtgattgctacggaactaaactcaacaaaaaagtttttgtgattttgatgataaagttgttagttactatctttgtgtggt |
29769923 |
T |
 |
| Q |
480 |
tgaaattgggaatggaatcggaaaaaacgtgatgttgttatcacgggaaaagagtctatctaggttgagaagtttacgtgtgactttgctacgtggtaac |
579 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29769924 |
tgaaattgggaatggaatcggaaaaaacgtgatgttgttatcacgggaaaagagtctatgtaggttgagaagtttacgtgtgactttgctatgtggtaac |
29770023 |
T |
 |
| Q |
580 |
tagctttttgttgtgtaggatgac |
603 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29770024 |
tagctttttgttgtgtaggatgac |
29770047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 3e-19; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 16977884 - 16977933
Alignment:
| Q |
1 |
ccatcacctctctaaccaaatcctcgaccacattcaagtattttctaccg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16977884 |
ccatcacctctctaaccaaatcctcgaccacattcaagtattttctaccg |
16977933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 264 - 304
Target Start/End: Original strand, 16978144 - 16978184
Alignment:
| Q |
264 |
tccaaatcaacaaagtttttatctttatcatcaaactcacc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16978144 |
tccaaatcaacaaagtttttatctttatcatcaaactcacc |
16978184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 122 - 151
Target Start/End: Original strand, 16978002 - 16978031
Alignment:
| Q |
122 |
atcatcatagtgagagccagaagaactatt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16978002 |
atcatcatagtgagagccagaagaactatt |
16978031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University