View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19815_high_3 (Length: 305)
Name: NF19815_high_3
Description: NF19815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19815_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 66 - 283
Target Start/End: Complemental strand, 36672815 - 36672597
Alignment:
| Q |
66 |
taaaataattgatacaccatttgaataggagagtggacccc-ggtttagggggtggtccagcattttctttttactgtcctacaaggaaactgtatagaa |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36672815 |
taaaataattgatacaccatttgaataggagagtggacccccggtttagggggtggtccagcattttctttttactgtcctacaaggaaactgtatagaa |
36672716 |
T |
|
| Q |
165 |
ccgtactcgtataacccaatacagtagtatagtaaccgtagccgtagtaacgttgctttcgcagtacttcaaatgcctctgtctgggaaccaatcttata |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36672715 |
ccgtactcgtataacccaatacagtagtatagtaaccgtagccgtagtaacgttgctttcgcagtacttcaaatgcctctgtctgtgaaccaatcttata |
36672616 |
T |
|
| Q |
265 |
cacagaagaatcacagaac |
283 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36672615 |
cacagaagaatcacagaac |
36672597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 52198039 - 52198103
Alignment:
| Q |
1 |
aaatactgtatttccatacggtgtcagtattgtgtctaattttttgtgtctggttatcactgctc |
65 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52198039 |
aaataccgtatttctatacggtgtcagtattgtgtctaattttttgtgtctggttatcactgctc |
52198103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 9 - 64
Target Start/End: Original strand, 8213352 - 8213407
Alignment:
| Q |
9 |
tatttccatacggtgtcagtattgtgtctaattttttgtgtctggttatcactgct |
64 |
Q |
| |
|
|||||| |||||||||| |||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
8213352 |
tatttctatacggtgtcggtattgtgtctatatttttgtgtttggttatcattgct |
8213407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University