View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19815_low_4 (Length: 284)
Name: NF19815_low_4
Description: NF19815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19815_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 10 - 187
Target Start/End: Original strand, 38296675 - 38296852
Alignment:
| Q |
10 |
ataatactttcattgaagttaacgggtgaagaaagagtggaactttttacgttaaaacttacaacctggaaccaataagttttacttacttataaaacat |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38296675 |
ataacactttcattgaagttaacgggtgaagaaagagtggaactttttacgttaaaacttacaacctggaaccaataagttttacttacttataaaacat |
38296774 |
T |
 |
| Q |
110 |
taataaagggaggttgggtagtttaaggatttgagttaagcgttgaaagggtctgatgagttaaatgatcaaaattca |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38296775 |
taataaagggaggttgggtagtttaaggatttgagttaagcgttgaaagggtctgatgagttaaatgatcaaaattca |
38296852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 203 - 232
Target Start/End: Original strand, 38296862 - 38296891
Alignment:
| Q |
203 |
caaagatcaaaatttacatcttggtgaaag |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38296862 |
caaagatcaaaatttacatcttggtgaaag |
38296891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University