View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19816_high_4 (Length: 333)
Name: NF19816_high_4
Description: NF19816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19816_high_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 11 - 333
Target Start/End: Original strand, 28988029 - 28988348
Alignment:
| Q |
11 |
tcataggtagtgagttgttactagtaagttctgaagcacggacacctcttagattaggtgtttcctgtatccaaaacgcaccggtgtctgacactgacac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28988029 |
tcataggtagtgagttgttactagtaagttctgaagcacggacacctcttagattaggtgtttcctgtgtccaaaacgcaccggtgtctgacactgacac |
28988128 |
T |
 |
| Q |
111 |
aacacctacacataaatcacctgtgtcgacgtatccgtgtcagtgtcgtgtcggtgtctgcttcgtagctagtaaagtctaagttagaattttggagctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28988129 |
aacacctacacataaatcacctgtgtcgacgtatccgtgtcagtgtcgtgtcggtgtctgcttcgtagctagtaaagtataagttagaattttggagctt |
28988228 |
T |
 |
| Q |
211 |
taaataattgtagtgtggtgggggaaaaataccttttcttctttcttttctctgaggttgtgtacattgattatgttaatgatgcttccgggttctgatt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
28988229 |
taaataattgtagtgtggtgggggaaaaataccttttcttctttcttttctctgaggttgtgtac---gattatgttaatgatgcttctgggttctgatt |
28988325 |
T |
 |
| Q |
311 |
ttgagccctgttattttgtggct |
333 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28988326 |
ttgagccctgttattttgtggct |
28988348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 133 - 162
Target Start/End: Original strand, 44572654 - 44572683
Alignment:
| Q |
133 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44572654 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
44572683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University