View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19816_high_6 (Length: 327)

Name: NF19816_high_6
Description: NF19816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19816_high_6
NF19816_high_6
[»] chr2 (2 HSPs)
chr2 (198-308)||(22996457-22996565)
chr2 (55-130)||(37559103-37559178)
[»] chr4 (1 HSPs)
chr4 (14-111)||(21359502-21359600)


Alignment Details
Target: chr2 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 198 - 308
Target Start/End: Complemental strand, 22996565 - 22996457
Alignment:
198 acatattatgtaatgcagctggtctaagattcaaaccgtctcgttaaaatgaaatagagctaactgttgatgtgtaagttattaataatgaataaatcca 297  Q
    |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| || ||||  ||||||||||||||||||||||||||||    
22996565 acatatcatgtaatgcagctgatctaagattcaaaccgtctcgttaaaatgaaatagagctatctattga--tgtaagttattaataatgaataaatcca 22996468  T
298 aataacttatt 308  Q
    |||||||||||    
22996467 aataacttatt 22996457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 55 - 130
Target Start/End: Original strand, 37559103 - 37559178
Alignment:
55 gtatataatacaaacttgaaattccacacgccatggacaaactatgcattgatgtttttgatttatatgttgaata 130  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||  |||||| ||||||||||||||||||    
37559103 gtatataatacaaacttgagattccacacgccatggacaaactatgcatgcatgtttctgatttatatgttgaata 37559178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 14 - 111
Target Start/End: Complemental strand, 21359600 - 21359502
Alignment:
14 gctgttgcaatcttgtcttcactacctgca-aaaagcatcaggtatataatacaaacttgaaattccacacgccatggacaaactatgcattgatgttt 111  Q
    |||| ||||||||| ||||||| ||||||| |||| ||  ||||||||||||||| ||||  |||||||| |||| ||||||||||||||| |||||||    
21359600 gctgctgcaatcttatcttcaccacctgcagaaaaacacaaggtatataatacaagcttgggattccacatgccaaggacaaactatgcatggatgttt 21359502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University