View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19817_low_4 (Length: 284)
Name: NF19817_low_4
Description: NF19817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19817_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 22905537 - 22905724
Alignment:
| Q |
18 |
attaggtggaacatctggagtttgat--ggattgatgaaatctccttcagtcttcatatgtaggatgtattccatgacgacatcttcattgtctagctta |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22905537 |
attaggtggaacatctggagtttgatcaggattgatgaaatctccttcagtcttcatatgtaggatgtattccttgacgacatcttcattgtctagctta |
22905636 |
T |
 |
| Q |
116 |
aagatgatgggaaaatcttcaaggtatactggattagttttcctgatacataatgtcatattag-aaggtttggccttctttattatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
22905637 |
gagatgatgggaaaatcttcaaggtatactggattagtattcctgatacataatgccatattagaaaggtttggacttctttattatt |
22905724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University