View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1981_high_5 (Length: 236)
Name: NF1981_high_5
Description: NF1981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1981_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 1891055 - 1891265
Alignment:
| Q |
12 |
cttcgtgattttgtcaaactataagcgatttcaaacacgcacttagtatttatacagactaatttcttcttgttttttcttatgatgtctgtttgcagat |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1891055 |
cttcgtgattttgtcaaactatatgcgatttcaaacacgcacttagtatttatacagactaatttcttcttgttttttcttatgatgtctgtttgcagat |
1891154 |
T |
|
| Q |
112 |
tggttccaccactaagtttctccacaatattgaaaagtgtgcttcttggagcaatagggtaatgccaaaatggtcttatcctttactccaattattgtta |
211 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1891155 |
tgcttccaccactaagtttctccacaatattgaaaagtgtgcttcttggagcaatagggtaatgccaaaatgatcttatcctttactccaattattgtta |
1891254 |
T |
|
| Q |
212 |
atgtgtctttt |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
1891255 |
atgtgtctttt |
1891265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 203
Target Start/End: Original strand, 1895942 - 1896026
Alignment:
| Q |
120 |
ccactaagtttctccacaatattgaaaagtgtgcttcttggagcaatagggtaatgcc-aaaatggtcttatcctttactccaat |
203 |
Q |
| |
|
||||| |||||||||| | ||| |||| ||| |||||||| |||||||||||||||| ||||||| ||||| ||||||| |||| |
|
|
| T |
1895942 |
ccactcagtttctccatagtatgcaaaattgtacttcttggtgcaatagggtaatgccaaaaatggccttatactttactacaat |
1896026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 181
Target Start/End: Original strand, 1905803 - 1905858
Alignment:
| Q |
126 |
agtttctccacaatattgaaaagtgtgcttcttggagcaatagggtaatgccaaaa |
181 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
1905803 |
agtttctctataatatgtaaaagtgtgcttcttggtgcaatagggtaatggcaaaa |
1905858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 1884378 - 1884432
Alignment:
| Q |
120 |
ccactaagtttctccacaatattgaaaagtgtgcttcttggagcaatagggtaat |
174 |
Q |
| |
|
||||| |||||||||| ||||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
1884378 |
ccactcagtttctccataatatgcaaaattgtgcttcttggagcgatagggtaat |
1884432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University