View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1981_low_10 (Length: 247)
Name: NF1981_low_10
Description: NF1981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1981_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 232
Target Start/End: Original strand, 3087808 - 3088021
Alignment:
| Q |
19 |
caaataactgttattcttgaagggtattattggaatcataattatgataaagtaattgatgatttctatatgattgataggcacttttaaagcctgaggc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3087808 |
caaataactgttattcttgaagggtattattggaatcataattatgataaagtaattgatgatttctatatgattgataggcacttttaaagcctgaggc |
3087907 |
T |
|
| Q |
119 |
atcagaagcagttcatcatttgttacctccccatgtcaatggtaacttatcagccttatgtgtatggcctgatcaaattaggcactggtacaaatataga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3087908 |
atcagaagcagttcatcatttgttacctccccatgtcaatggtaacttatcagccttatgtgtatggcctgatcaaattaggcactggtacaaatataga |
3088007 |
T |
|
| Q |
219 |
tggacaagtccact |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3088008 |
tggacaagtccact |
3088021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University