View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1981_low_14 (Length: 221)
Name: NF1981_low_14
Description: NF1981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1981_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 24 - 201
Target Start/End: Complemental strand, 12020710 - 12020540
Alignment:
| Q |
24 |
ccgatacattaaaatcatttgaaactcgatataaatagcaatgtatatagtatatggttatagaaaaaggaaataaatttgtgaataaataatgaaaatg |
123 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12020710 |
ccgatacgttaaaatcatttgaaactcgatataaatagcaatgtatat-------ggttatagaaaaaggaaataaatttgtgaataaataatgaaaatg |
12020618 |
T |
 |
| Q |
124 |
gaatttgagcttgccttggagttaatttgaagagaggggtgacgaataggttctttagaataatctgaaggacctgtg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12020617 |
gaatttgagcttgccttggagttaatttgaagagaggggtgacgaataggttctttagaataatctgaaggacctgtg |
12020540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University