View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1981_low_15 (Length: 216)
Name: NF1981_low_15
Description: NF1981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1981_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 29579263 - 29579072
Alignment:
| Q |
18 |
aaaagttgataatatattataaaaagttcacattttaaaggtttcatcaaacacttttgttgagcaaaagaaataaataaaaaatacctggactttagat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||| || |||||||||||| |
|
|
| T |
29579263 |
aaaagttgataatatattataaaaagttcacattttaaaggtatcatcaaacacttttgttgagcaaaaaaacaaaataaaaaacacttggactttagat |
29579164 |
T |
 |
| Q |
118 |
tttggaggcaca--------taacatgagtagggtccttaacatccactgaatcctccaatggaattcatgcgtgttttggttgttctaact |
201 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
29579163 |
tttggaggcacactggagagacacatgagtagggtccttaacatccactgaatcctccaatggaattcatgcgtgtttgtgttgatctaact |
29579072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University