View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1981_low_17 (Length: 211)
Name: NF1981_low_17
Description: NF1981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1981_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 33 - 192
Target Start/End: Complemental strand, 8518763 - 8518606
Alignment:
| Q |
33 |
agtcttcatcttaataactttctgaggcaaatatcatattctgtactcagccagcttctgtttcataattcatattccaattccttataaaaccatagat |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8518763 |
agtcttcatcttaataactttctgaggcaaatatcatattctg--ctcagccagcttctgtttcataattcatattccaattccttataaaaccatagat |
8518666 |
T |
|
| Q |
133 |
tatgaaaatggggcataacccatatgtcataattaagaagttctctaaccaagtaatttt |
192 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8518665 |
tctgaaaatggggcataacccatatgtcataattaagaagttctctaacaaagtaatttt |
8518606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University