View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19821_high_6 (Length: 241)
Name: NF19821_high_6
Description: NF19821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19821_high_6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 7 - 241
Target Start/End: Original strand, 396593 - 396827
Alignment:
| Q |
7 |
gtattaacatttctctaatttccatttttgggtttttacaggttttatgttgcagaagttctccttgctttggagtacttgcacatgcttggaataatct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
396593 |
gtattaacatttctctaatttccatttttgggtttttacaggttttatgttgcagaagttctccttgctttggagtacttgcacatgcttggaataatct |
396692 |
T |
|
| Q |
107 |
atagagaccttaaaccggagaatgtgttggtgagagaagatggtcatatcatgctctcagatttcgatctctctctaaggtgcaccgtcagtccaactct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
396693 |
atagagaccttaaaccggagaatgtgttggtgagagaagatggtcatatcatgctctcagatttcgatctctctctaaggtgcaccgtcagtccaactct |
396792 |
T |
|
| Q |
207 |
agtgaagtcatcaaacccgatcactgaaactaaaa |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
396793 |
agtgaagtcatcaaacccgatcactgaaactaaaa |
396827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 45 - 215
Target Start/End: Complemental strand, 12234276 - 12234106
Alignment:
| Q |
45 |
caggttttatgttgcagaagttctccttgctttggagtacttgcacatgcttggaataatctatagagaccttaaaccggagaatgtgttggtgagagaa |
144 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
12234276 |
caggttttatgtagcagaagttctccttgctttggagtacttgcacatgcttggaatcatctacagagaccttaagcccgagaacgtgttggtgagagaa |
12234177 |
T |
|
| Q |
145 |
gatggtcatatcatgctctcagatttcgatctctctctaaggtgcaccgtcagtccaactctagtgaagtc |
215 |
Q |
| |
|
|||||||| || ||||| || |||||||||||||||||||| || |||| ||||||||||| || ||||| |
|
|
| T |
12234176 |
gatggtcacataatgctatcggatttcgatctctctctaagatgtgccgttagtccaactctcgttaagtc |
12234106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 45 - 99
Target Start/End: Complemental strand, 42196991 - 42196937
Alignment:
| Q |
45 |
caggttttatgttgcagaagttctccttgctttggagtacttgcacatgcttgga |
99 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42196991 |
caggttttatgttgctgaagtcctccttgctttggagtacttgcacatgcttgga |
42196937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 95
Target Start/End: Original strand, 26484831 - 26484881
Alignment:
| Q |
45 |
caggttttatgttgcagaagttctccttgctttggagtacttgcacatgct |
95 |
Q |
| |
|
||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
26484831 |
caggttttatgttgctgaagtccttcttgctttggagtacttgcacatgct |
26484881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 184
Target Start/End: Complemental strand, 6073085 - 6072943
Alignment:
| Q |
42 |
ttacaggttttatgttgcagaagttctccttgctttggagtacttgcacatgcttggaataatctatagagaccttaaaccggagaatgtgttggtgaga |
141 |
Q |
| |
|
|||||||||||||| || ||||| || | || |||||||| |||||||| | ||||||||||| ||||| | || ||||| || ||||| || ||| |
|
|
| T |
6073085 |
ttacaggttttatgcggctgaagtactggtggcattggagtatctgcacatgttaggaataatctacagagatttaaagccggaaaacgtgttagtcaga |
6072986 |
T |
|
| Q |
142 |
gaagatggtcatatcatgctctcagatttcgatctctctctaa |
184 |
Q |
| |
|
|| ||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
6072985 |
tcggacggtcacatcatgctctcagattttgatctctcactaa |
6072943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 176
Target Start/End: Complemental strand, 1035272 - 1035184
Alignment:
| Q |
88 |
cacatgcttggaataatctatagagaccttaaaccggagaatgtgttggtgagagaagatggtcatatcatgctctcagatttcgatct |
176 |
Q |
| |
|
|||||||||||| | | || |||||||||||||| || ||||||||||| |||| |||||||| || ||||| || ||||| ||||| |
|
|
| T |
1035272 |
cacatgcttggagttgtgtacagagaccttaaacctgaaaatgtgttggttcgagacgatggtcacataatgctttcggattttgatct |
1035184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University