View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19821_high_7 (Length: 232)
Name: NF19821_high_7
Description: NF19821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19821_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 216
Target Start/End: Original strand, 41734144 - 41734354
Alignment:
| Q |
10 |
catcatcaacgtcattcttatggtgattgtgacgggattgcggtggacggggatggcgtcggcgtttgagggaagcagtgggagccggagccggaggtgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41734144 |
catcatcaacgtcattcttatggtgattgtgacgggattgcggtggacggggatggcgtcggcgtttgagggaagcagtgggagccggagccggaggtgg |
41734243 |
T |
|
| Q |
110 |
ttggtcgtcggaagtaatgttaccggtggcgatgttgtaagctgaagaatataaaatcggtgagtgaa----agatagagagagatggaattggaattgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41734244 |
ttggtcgtcggaagtaatgttaccggtggcgatgttgtaagctgaagaatataaaatcggtgagtgaaagatagatagagagagatggaattggaattgg |
41734343 |
T |
|
| Q |
206 |
aatgaggaaag |
216 |
Q |
| |
|
||||||||||| |
|
|
| T |
41734344 |
aatgaggaaag |
41734354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University