View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19822_high_12 (Length: 218)
Name: NF19822_high_12
Description: NF19822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19822_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 7439742 - 7439531
Alignment:
| Q |
1 |
tatgtgttatttgattcaaaattaataataacattcaaatttttatatgcatgctataagttacatttagggta-actctcatattcgacaagtatgcta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
7439742 |
tatgtgttatttgattcaaaattaataata-cattcaaatttttatatgcatgctataagttacatctagggcctactctcatattcgacaagtatgcta |
7439644 |
T |
 |
| Q |
100 |
cattgatacaagacattaaaaatctcaacaattttaactgactagcttttattgattacacactctgagttttcgacaatagttgtgctgacttcctagg |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7439643 |
cattgatacaagacattaagaatctcaacaattttgactggctagcttttattggtcacacactctgagttttcgacaatagttgtgctgacttcctagg |
7439544 |
T |
 |
| Q |
200 |
gtttagggtatat |
212 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7439543 |
gtttagggtatat |
7439531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University