View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19822_low_8 (Length: 265)
Name: NF19822_low_8
Description: NF19822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19822_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 50369937 - 50369697
Alignment:
| Q |
18 |
tcaactccctcaatccttttccctttttaaaaacttgatcctatccatggaggattctcagtttgacgtgattattgtcggagccggcgtcatgggaagt |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369937 |
tcaactccctcaatccttttcccttgttaaaaacttgatcctatccatggaggattctcagtttgacgtgattattgtcggagccggcgtcatgggaagt |
50369838 |
T |
 |
| Q |
118 |
tccaccgcctaccaagcagccaaaaggggtctcaaaacactcttgcttgaacaatttgactttctccaccaccgtggctcttcccacggtgaatcccgca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369837 |
tccaccgcctaccaagcagccaaaaggggtctcaaaacactcttgcttgaacaatttgactttctccaccaccgtggctcttcccacggtgaatcccgca |
50369738 |
T |
 |
| Q |
218 |
caattcgtgctacctatattcaaaaccattactaccctatg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369737 |
caattcgtgctacctatattcaaaaccattactaccctatg |
50369697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 88 - 224
Target Start/End: Complemental strand, 50380033 - 50379897
Alignment:
| Q |
88 |
attattgtcggagccggcgtcatgggaagttccaccgcctaccaagcagccaaaaggggtctcaaaacactcttgcttgaacaatttgactttctccacc |
187 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||| | || |||||| | || |||||||| || | || |||||||| || ||||| |||| |
|
|
| T |
50380033 |
attattgtcggcgccggcgtcatgggaagctccaccgcctactacgctgccaaacgaggcctcaaaaccctggttctcgaacaattcgattttcttcacc |
50379934 |
T |
 |
| Q |
188 |
accgtggctcttcccacggtgaatcccgcacaattcg |
224 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||| |
|
|
| T |
50379933 |
accgtggttcctcccacggtgaatcccgcacaattcg |
50379897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University