View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19824_high_12 (Length: 272)
Name: NF19824_high_12
Description: NF19824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19824_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 65 - 223
Target Start/End: Original strand, 8355556 - 8355714
Alignment:
| Q |
65 |
tgtttattattcaatcataatctaatgagtaatacatgcaaatagagtgacgagttttcaatcttgttgccaagggttgaaaattgcctcttatggttgt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8355556 |
tgtttattattcaatcataatctaatgagtaatacatgcaaatagagtgacgagttttcaatcttgttgccaagggttgaaaattgcctcttatggttgt |
8355655 |
T |
|
| Q |
165 |
taggatcacatcttatgccttcactgctaaaagccttatgttaattgggtggtaaatga |
223 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8355656 |
taggatcacatcttatgccttcacggctaaaagccttatgttaattgggtggtaaatga |
8355714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 8355609 - 8355540
Alignment:
| Q |
1 |
ctcgtcactctatttgcatgtattactcattagattatgattgaataataaacatctatggtattgttta |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8355609 |
ctcgtcactctatttgcatgtattactcattagattatgattgaataataaacatctatggtactgttta |
8355540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University