View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19824_low_12 (Length: 314)
Name: NF19824_low_12
Description: NF19824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19824_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 43 - 296
Target Start/End: Original strand, 51718444 - 51718702
Alignment:
| Q |
43 |
aattgtatttctacaatattttgagacaactctctcatacattct------ctttgtgtttttacactatcttcatctctctattattttttatcaataa |
136 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||| ||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51718444 |
aattgtatttttacaatattttgagacaactctttcatacattctctttctctttgtgcttttacattatcttcatctctctattattttttatcaataa |
51718543 |
T |
|
| Q |
137 |
aaagagaaagaatgttgtctagggattgtagtcgtataaatatcgttactcaaaatgaaagtttaaatgtgtgtataaattactacccatttttcttggt |
236 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51718544 |
aaagagagagaatgttgtctagggattgtagtcgtataaatatcgttactcaaaatgaaagtttaaatgtgtgtataaattactacccatttttcttggt |
51718643 |
T |
|
| Q |
237 |
gttcaaactacatcgatctttctgaaagaagaggagtaaacaaagtgttttggtttgttg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51718644 |
gttcaaactacatcgatctttctgaaagaagaggagtaaacaaagtg-tttggtttgttg |
51718702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University