View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19824_low_14 (Length: 295)
Name: NF19824_low_14
Description: NF19824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19824_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 280
Target Start/End: Complemental strand, 11826694 - 11826430
Alignment:
| Q |
14 |
atatagaatagctactcgtgtgtacgcattaagaaacatgattaattagtgcactttgttattttgctgtnnnnnnnnnnnncgtgtcgttgattacttt |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
11826694 |
atatagaatagctactcgtgtgtatgcattaagaaacatgattaattagtgcactttgttattttgctgttatatatatat--gtgtcgttgattgcttt |
11826597 |
T |
|
| Q |
114 |
atatatgttaaaattttcatagctagatcaatgaaatatttctacttccaagatatcttttttgctgttgtacattttggcataaaaaatgtcagtattg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11826596 |
atatatgttgaaattttcatagctagatcaatgaaatatttctacttccaagatatcttttttgctgttgtacattttggcataaaaaatgttagtattg |
11826497 |
T |
|
| Q |
214 |
tattgttagtttttatattgagggtggggatcaaactattgatttccttattattcacccttatatt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11826496 |
tattgttagtttttatattgagggtggggatcaaactattgatttccttattattcacccttatatt |
11826430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 102 - 161
Target Start/End: Complemental strand, 11840389 - 11840334
Alignment:
| Q |
102 |
gttgattactttatatatgttaaaattttcatagctagatcaatgaaatatttctacttc |
161 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
11840389 |
gttgattgctttatatatgttgaaattttca----tcgatcaatgaaatatttctacttc |
11840334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 213 - 249
Target Start/End: Original strand, 35040359 - 35040395
Alignment:
| Q |
213 |
gtattgttagtttttatattgagggtggggatcaaac |
249 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35040359 |
gtattgttagtttttatgctgagggtggggatcaaac |
35040395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University