View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19825_high_17 (Length: 285)
Name: NF19825_high_17
Description: NF19825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19825_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 34120452 - 34120726
Alignment:
| Q |
1 |
ccaagcaagttaacttcatctcttctcaccttaatcttctcttccaaactaagttcaaaaaatttgtttgcagattcttcaattctctcacgtttatcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120452 |
ccaagcaagttaacttcatctcttctcactttaaccttctcttccaaactaagttcaaaaaatttgtttgcagattcttcaattctctcacgtttatcca |
34120551 |
T |
 |
| Q |
101 |
aaggcactttgtgattaataacttgaaagaaaccccattctttacatgcttgaccaatttctttgaccaagttttggatggaaagtgagttggtttcatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34120552 |
aaggcactttgtgattaataacttgaaagaaaccccattctttacatgcttgaccaatttctttgaccaagttttcgatggaaagtgagttggtttcatc |
34120651 |
T |
 |
| Q |
201 |
atcttggtagtttatgggagagagatcaattagagggatgccttcagcaatgattatggaagattttggtctgtg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34120652 |
atcttggtagtttatgggagagagatcaattagagggatgctttcagcaatgattatggaagattttggtctgtg |
34120726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 226 - 275
Target Start/End: Complemental strand, 32717342 - 32717293
Alignment:
| Q |
226 |
tcaattagagggatgccttcagcaatgattatggaagattttggtctgtg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32717342 |
tcaattagagggatgccttcagcaatgattatggaagattttggtctgtg |
32717293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 226 - 275
Target Start/End: Original strand, 10638269 - 10638318
Alignment:
| Q |
226 |
tcaattagagggatgccttcagcaatgattatggaagattttggtctgtg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10638269 |
tcaattagagggatgccttcagcaatgattatggaagattttggtatgtg |
10638318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University