View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19825_high_3 (Length: 483)
Name: NF19825_high_3
Description: NF19825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19825_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 406; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 406; E-Value: 0
Query Start/End: Original strand, 1 - 469
Target Start/End: Original strand, 44585502 - 44585971
Alignment:
| Q |
1 |
taacagtcgatctcaccatttcaagcacgggtcttgttcatgtggtgattcttggtgatgcaatagtttttgttggaaaccccgcgatgacttcaacact |
100 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||| |||||||||| |||| | |||| |||||||| |
|
|
| T |
44585502 |
taacagtcgatttcaccatttcaagaacgggtcttgttcatgtggtgattattggtgaagcaatagttattgttggaaatcccgtgttgacctcaacact |
44585601 |
T |
|
| Q |
101 |
aaccgagaggtgaattaagaaagcaaagaaactgaattcaggacgaaatatgggtcaggttaagatacttgtgctgcactaagattgcgctctcagcttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44585602 |
aaccgagaggtgaattaagaaagcaaagaaactgaattcaggactaaatatgggtcaggttaagatacttgtgctgcactaagattgcgctctcagcttg |
44585701 |
T |
|
| Q |
201 |
atgaagagagggtttggtcctgatttcacattgtctgatttcatgtcaagtatctgaattgagttctgatttcctaccttatgagcagcactgtgagtgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44585702 |
atgaagagagggtttggtcctgatttcacattgtctgatttcatgtcaagtatctgaattgagttctgatttcctaccttatgagcagcactgtgagtgt |
44585801 |
T |
|
| Q |
301 |
ttaattacttcattttattttattacttcttgctgggttcagcacaaattccctccgatggtgcg-tttcattgtatatttgacctccttgttatttcaa |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
44585802 |
ttaattacttcattttattttattacttcttgctgggttcagcacaaattccctccgatggtgcgttttcattgcatatttgacctccttgttatttcaa |
44585901 |
T |
|
| Q |
400 |
taacattttaatgaacaggaacattcaagttttgattggtgtgcctgccaatattcactgtctgcctatg |
469 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44585902 |
taacattttaatgaacagtaacattcatgttttgattggtgagcctgccaatattcactgtctgcctatg |
44585971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University