View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19825_high_32 (Length: 221)
Name: NF19825_high_32
Description: NF19825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19825_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 25145795 - 25145650
Alignment:
| Q |
1 |
ttccctttaaaactttctacaattcttgacctaaaagttataaagactatatgttatagtaaatgtagcagagaaatttggatgaagcacaaagtgtaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
25145795 |
ttccctttaaaactttctacaattcttgacctaaaagttattaagactatatgttatagtaaatgaagcagacaaatttggatgaagcacaaagtgtaat |
25145696 |
T |
 |
| Q |
101 |
atgtcatatatttacttgagaaaaaagtaagattaaaaatttcaaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25145695 |
atgtcatatatttacttgagaaaaaagtaagattaaaaatttcaaa |
25145650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 135 - 205
Target Start/End: Complemental strand, 25145606 - 25145536
Alignment:
| Q |
135 |
aaaaatttcaaatttgtcaacaaagtattaaatttgtttgtgaaaatttactaaaataaattggataattc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25145606 |
aaaaatttcaaatttgtcaacaaagtattaaatttgtttgtgtaaatttactaaaataaattggataattc |
25145536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University