View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19825_high_9 (Length: 403)
Name: NF19825_high_9
Description: NF19825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19825_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 12 - 387
Target Start/End: Complemental strand, 43603010 - 43602635
Alignment:
| Q |
12 |
atgaagaaaaagagatgcaaacattgctaacataaagtctcaaatttccctagctttgccttaaactactcatttcttttgataattaataaatttacaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43603010 |
atgaagaaaaagagatgcaaacattgctaacataaagtctcaaatttccctagctttgccttaaactactcatttcttttgataattaataaatttacaa |
43602911 |
T |
|
| Q |
112 |
ggatcggcaaaccgaacagagaaagatctagacaggtaatctggttcatcaaacactgtcccttgttcaaaattctgagaataagtgaaaggatcataag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602910 |
ggatcggcaaaccgaacagagaaagatctagacaggtaatctggttcatcaaacactgtcccttgttcaaaattctgagaataagtgaaaggatcataag |
43602811 |
T |
|
| Q |
212 |
gatcctgctgcaaaggtgatgatgtagactcaagtagcttcttcttctctttcttgagcttcatccacaacattttccatctaaatttacttgatcttgt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602810 |
gatcctgctgcaaaggtgatgatgtagactcaagtagcttcttcttctctttcttgagcttcatccacaacattttccatctaaatttacttgatcttgt |
43602711 |
T |
|
| Q |
312 |
agctgctgatagagagtttgtgtgctcgatatcatagcaaaatcttcccaattctttggtcttcctgctagaattg |
387 |
Q |
| |
|
|| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602710 |
agttgctgatagagagtttgtgtgctcgatttcatagcaaaatcttcccaattctttggtcttcctgctagaattg |
43602635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University