View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19825_low_13 (Length: 368)
Name: NF19825_low_13
Description: NF19825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19825_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 19 - 358
Target Start/End: Complemental strand, 39529500 - 39529161
Alignment:
| Q |
19 |
aactagctgattgtaaattcattctcactttactcatgcgctgaccatatcttcatgtttacgttggtgaagtgctagagtgagaagaagagcttttatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39529500 |
aactagctgattgtaaattcattctcgctttactcatgcgctgaccatatcttcatgtttacgttggtgaagtgctagagtgagaagaagagcttttatt |
39529401 |
T |
 |
| Q |
119 |
agcaattgtaggaattattttcaagggatcatatttatgacatttttgccatttttgtcgatgaagcacaaacaagatatgagtatcggatgcgatacgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39529400 |
agcaattgtaggaattattttcaagggatcatatttatgacatttttgccatttttgtcgacgaagcacaaacaagatatgagtatcggatgcgatacgt |
39529301 |
T |
 |
| Q |
219 |
taaggatgcttagtttgtaatgctccttgtttatgtctgttaccaacttatcatgcaaggttacttaaaatagaaatatatcttctttgtcatgttgttt |
318 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
39529300 |
taaggatacttagtttgtaatgctccttgtttatgtctgttaccaacttatcatgcaaggttacttaaaatagaaacatatcttctttgccatgttgttt |
39529201 |
T |
 |
| Q |
319 |
cggtttcaacttttgcattttcttttccccctttgctact |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39529200 |
aggtttcaacttttgcattttcttttccccctttcctact |
39529161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University