View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19825_low_21 (Length: 276)
Name: NF19825_low_21
Description: NF19825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19825_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 77 - 258
Target Start/End: Original strand, 6564789 - 6564970
Alignment:
| Q |
77 |
gttggtcttacccttcggccccgaggaaatggactctcgtaatttggatatgataagtaaagactggtcaaagattattcatgccatagtctaaacttgc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564789 |
gttggtcttacccttcggccccgaggaaatggactctcgtaatttggatatgataagtaaagactggtcaaagattattcatgccatagtctaaacttgc |
6564888 |
T |
|
| Q |
177 |
gtactcgtggtcaatttgattttcaccgaaactcatggactacttaagtctaaccacttggttttgaatataggcttctcat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564889 |
gtactcgtggtcaatttgattttcaccgaaactcatcgactacttaagtctaaccacttggttttgaatataggcttctcat |
6564970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 6564718 - 6564761
Alignment:
| Q |
19 |
ggtttgattgtaaggtcttaagaaacaaatgaccatttaaggtt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564718 |
ggtttgattgtaaggtcttaagaaacaaatgaccatttaaggtt |
6564761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University