View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19825_low_23 (Length: 267)
Name: NF19825_low_23
Description: NF19825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19825_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 23 - 263
Target Start/End: Original strand, 39528511 - 39528751
Alignment:
| Q |
23 |
agacttaaaaacacaaccatgctattgctattgtttcttttagaagaacnnnnnnngttaacacttactagcaacgtcatacacaataacggcgaccgaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39528511 |
agacttaaaaacacaaccatgctattgctattgtttcttttagaagaacaaagaaagttaatacttactagcaacgtcatacacaataacggcgaccgaa |
39528610 |
T |
|
| Q |
123 |
gaatctcttatataacttggaatgaggcttctaaatctttcttgccctgcagtatccctgtggagttaaaatagactacattcaaaatatgcnnnnnnnn |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39528611 |
gaatctcttatataacttggaatgaggcttctaaatctttcttgccctgcagtatccctgtggagttaaaatagactacattcaaaatatgcaaaaaaaa |
39528710 |
T |
|
| Q |
223 |
ngggtaaaatagcatctacgccacaatgtgtaatctactac |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39528711 |
tgggtaaaatagcatctacgccacaatgtgaaatctactac |
39528751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 85 - 182
Target Start/End: Original strand, 37853183 - 37853280
Alignment:
| Q |
85 |
acttactagcaacgtcatacacaataacggcgaccgaagaatctcttatataacttggaatgaggcttctaaatctttcttgccctgcagtatccctg |
182 |
Q |
| |
|
||||||| || || ||||| |||||||| || || |||||||||||||| || ||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
37853183 |
acttactggctacatcatatacaataacagcaacagaagaatctcttatgtagcttggaatgagacttctaaatctttcttggcctgcagtatccctg |
37853280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University