View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19825_low_30 (Length: 249)

Name: NF19825_low_30
Description: NF19825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19825_low_30
NF19825_low_30
[»] chr4 (1 HSPs)
chr4 (6-50)||(32181853-32181897)


Alignment Details
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 6 - 50
Target Start/End: Original strand, 32181853 - 32181897
Alignment:
6 agatctaaaacaatagttctaggaaaatctcaagaaaagaaaaaa 50  Q
    |||||||||||||||||||||||||||||||||| ||||||||||    
32181853 agatctaaaacaatagttctaggaaaatctcaaggaaagaaaaaa 32181897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University