View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19825_low_31 (Length: 240)

Name: NF19825_low_31
Description: NF19825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19825_low_31
NF19825_low_31
[»] chr3 (3 HSPs)
chr3 (1-98)||(27261199-27261296)
chr3 (1-98)||(51267093-51267190)
chr3 (164-230)||(27261071-27261138)
[»] chr7 (4 HSPs)
chr7 (7-98)||(19290052-19290144)
chr7 (28-98)||(3958730-3958799)
chr7 (1-93)||(27844566-27844658)
chr7 (164-230)||(19289865-19289932)
[»] chr4 (2 HSPs)
chr4 (1-97)||(26677421-26677517)
chr4 (7-74)||(13980769-13980836)
[»] chr2 (1 HSPs)
chr2 (32-96)||(23649834-23649899)
[»] chr8 (1 HSPs)
chr8 (10-59)||(13995135-13995184)


Alignment Details
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 27261296 - 27261199
Alignment:
1 taaatagtggcaaaatggatggtgaccaacgggagggttagcgaggttattggtgtttgtgtggtgtgatggagatagttgcttgcgtgatggttggg 98  Q
    ||||| || |||||||||||||||  ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||    
27261296 taaatggtagcaaaatggatggtggtcaacgggagggttagcgaggttattggtgtttgcgtggtgtgatggaaatagttgcttgcgtgatggttggg 27261199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 51267190 - 51267093
Alignment:
1 taaatagtggcaaaatggatggtgaccaacgggagggttagcgaggttattggtgtttgtgtggtgtgatggagatagttgcttgcgtgatggttggg 98  Q
    ||||| |||||||||||| ||||| ||||||||| || ||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||    
51267190 taaatggtggcaaaatgggtggtggccaacgggaagggtagcgaggttattagtgtttgtgtggtgtgatggagatagttgcgtgcgtgatggttggg 51267093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 164 - 230
Target Start/End: Complemental strand, 27261138 - 27261071
Alignment:
164 atgttgttgtgcggagg-ttgtcttcgatttaggtgttcctttcactgctttcgaagatggtcctttg 230  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||    
27261138 atgttgttgtgcggagggttgtcttcgatttaggtgttcctttcactgctttcaaagatagtcctttg 27261071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 7 - 98
Target Start/End: Complemental strand, 19290144 - 19290052
Alignment:
7 gtggcaaaatggatggtgaccaacgggagggtt-agcgaggttattggtgtttgtgtggtgtgatggagatagttgcttgcgtgatggttggg 98  Q
    |||| ||||||| ||||| |||||||||||||| |||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||    
19290144 gtggtaaaatgggtggtggccaacgggagggtttagcgaggttattagtgtttgcgtggtgtgatggagatagctgcttgcgtgatggttggg 19290052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 28 - 98
Target Start/End: Original strand, 3958730 - 3958799
Alignment:
28 aacgggagggttagcgaggttattggtgtttgtgtggtgtgatggagatagttgcttgcgtgatggttggg 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| || | |||| ||||||||||||    
3958730 aacgggagggttagcgaggttattggtgtttgtgtggtgtgatggaga-agctacttgtgtgatggttggg 3958799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 27844658 - 27844566
Alignment:
1 taaatagtggcaaaatggatggtgaccaacgggagggtt-agcgaggttattggtgtttgtgtggtgtgatggagatagttgcttgcgtgatgg 93  Q
    ||||| |||||||||||| ||| | ||||| |||||||| | |||||||||||||||||| |||||||||||||||||| |||||| |||||||    
27844658 taaatggtggcaaaatgggtgggg-ccaacaggagggtttaacgaggttattggtgtttgcgtggtgtgatggagatagctgcttgtgtgatgg 27844566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 230
Target Start/End: Complemental strand, 19289932 - 19289865
Alignment:
164 atgttgttgtgcggaggt-tgtcttcgatttaggtgttcctttcactgctttcgaagatggtcctttg 230  Q
    |||||||||||||||||  |||||||||||| |||||| |||| |||  |||||||||| ||||||||    
19289932 atgttgttgtgcggaggggtgtcttcgattttggtgtttcttttactaatttcgaagatagtcctttg 19289865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 26677517 - 26677421
Alignment:
1 taaatagtggcaaaatggatggtgaccaacgggagggttagcgaggttattggtgtttgtgtggtgtgatggagatagttgcttgcgtgatggttgg 97  Q
    ||||| |||||||||| | ||||| ||||||||| || |||||||||||||||||||||  ||||||||||||||||||||| ||||||||||||||    
26677517 taaatggtggcaaaataggtggtggccaacgggaagggtagcgaggttattggtgtttgcttggtgtgatggagatagttgcgtgcgtgatggttgg 26677421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 7 - 74
Target Start/End: Complemental strand, 13980836 - 13980769
Alignment:
7 gtggcaaaatggatggtgaccaacgggagggttagcgaggttattggtgtttgtgtggtgtgatggag 74  Q
    |||||||||||| ||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||    
13980836 gtggcaaaatgggtggtggccaacgggagggttagcgagattattggtgtttgcgtggtgtgatggag 13980769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 32 - 96
Target Start/End: Original strand, 23649834 - 23649899
Alignment:
32 ggagggttagcgaggttattggtgtttgtgtggtgtgatggagatagttg-cttgcgtgatggttg 96  Q
    |||||||| |||||||||||||||||||||||||||||||||||||| || ||||| |||||||||    
23649834 ggagggtttgcgaggttattggtgtttgtgtggtgtgatggagatagctgtcttgcatgatggttg 23649899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 13995135 - 13995184
Alignment:
10 gcaaaatggatggtgaccaacgggagggttagcgaggttattggtgtttg 59  Q
    ||||||||| ||||| |||| |||||||||||||||||||||||||||||    
13995135 gcaaaatgggtggtggccaatgggagggttagcgaggttattggtgtttg 13995184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University