View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19825_low_5 (Length: 455)
Name: NF19825_low_5
Description: NF19825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19825_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 353; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 1 - 392
Target Start/End: Original strand, 41621533 - 41621925
Alignment:
| Q |
1 |
cttagagctgcaacattgccttccgtttttgcctttgtttcagcctgtccaatctgctacagcgcttctcataatctgatcatcatggtccaccgtgccc |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41621533 |
cttagagctgcaacattgccttctgtttttgcctttgttccagcctgtccaatctgctacagcacttctcataatctgatcatcatggtccaccgtgccc |
41621632 |
T |
|
| Q |
101 |
tgccagagtttaaggttcctgctgcaccaaatgctatagctaaccattgcaaaatgagttctgctatgctgttccagttttgtaaacaac-gaaaaacta |
199 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| ||||||||| |
|
|
| T |
41621633 |
tgccatagtttaaggttcctgctgcgccaaatgctatagctaaccattgcaaaatgagttctgctatcctgtttcagttttgtaaacaacagaaaaacta |
41621732 |
T |
|
| Q |
200 |
gctctttgaaactgttgcacctgatcagtaatggttccatcttgtcccacaatttgcttttgatccaactctcaatactttttggacattggatctgatg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41621733 |
gctctttgaaactgttgcacctgatcagtaatggttccatcttgtcccacaatttgcttttgatccaactctcaatactttttagacattggatctgatg |
41621832 |
T |
|
| Q |
300 |
aataagtgccaattgttctcatatccattctcactaggacaaatgatatccttctctctcaactttgttgcagttggcttaacatctctaacg |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41621833 |
aataagtgccaattgttctcatatccattctcactaggacaaatgatatccttctctctcaactttgttgcagttggcttaacatctctaacg |
41621925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 325 - 386
Target Start/End: Original strand, 41621951 - 41622012
Alignment:
| Q |
325 |
cattctcactaggacaaatgatatccttctctctcaactttgttgcagttggcttaacatct |
386 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||| |||||| ||||||||| |
|
|
| T |
41621951 |
cattctcactaggacaaatgacttccttctctctcaaccgtgttgtagttggtttaacatct |
41622012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University