View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19827_low_3 (Length: 206)
Name: NF19827_low_3
Description: NF19827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19827_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 11 - 185
Target Start/End: Original strand, 32679118 - 32679292
Alignment:
| Q |
11 |
aatatccaagtgtgaaaactttgtctgcgacaattatatggatggactataaaacccaaacaagggaatgacgtgtatatcttatcatttgtgcttggaa |
110 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32679118 |
aatatccaagtgtgaaaactttgtttgcgacaattatatggatggactataaaacccaaacaagggaatgacatgtatatcttatcatttgtgcttggaa |
32679217 |
T |
 |
| Q |
111 |
gaagatatcaaatagtaatacctcatgtctttctttcatagaaaatggaacagatggtaaaatatcttttgaacc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32679218 |
gaagatatcaaatagtaatacctcatgtctttctttcataggaaatggaacagatggtaaaatatcttttgaacc |
32679292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 11 - 185
Target Start/End: Complemental strand, 54225499 - 54225327
Alignment:
| Q |
11 |
aatatccaagtgtgaaaactttgtctgcgacaattatatggatggactataaaacccaaacaagggaatgacgtgtatatcttatcatttgtgcttggaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||| | ||||| ||||||| || |||||| |
|
|
| T |
54225499 |
aatatccaagtgtgaaaactttgtctgcaacaattatatggatggattataaaacccaaacaatggaatgacatagatatc-tatcatt--tggttggaa |
54225403 |
T |
 |
| Q |
111 |
gaagatatc-aaatagtaatacctcatgtctttctttcatagaaaatggaacagatggtaaaatatcttttgaacc |
185 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||| || |||||||||||||||| |||||||||||||||| |
|
|
| T |
54225402 |
gaagatatcaaaatagcaatacctcatgtctttctttcacaggaaatggaacagatggtgaaatatcttttgaacc |
54225327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University