View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19828_high_35 (Length: 311)
Name: NF19828_high_35
Description: NF19828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19828_high_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 10 - 296
Target Start/End: Complemental strand, 35748390 - 35748104
Alignment:
| Q |
10 |
attattctcgaccaaaacacaaggacgtttataacgggtaccgagactcaacaaatccttataataatcaccgtcgtaactttcatttacacgttttccg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35748390 |
attattctcgaccaaaacacaaggacgtttataacgggtaccgagactcaacaaatccttataataatcaccgtcgtaactttcatttacacgttttccg |
35748291 |
T |
|
| Q |
110 |
atcatcacaccggtgggaatcaccgtcaccggcaccgccgttggaaccctttgaacaatcgttgtaaccggtggaaccgctgcaggagccgctgtgcgac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35748290 |
atcatcacaccggtgggaatcaccgtcaccggcaccgccgttggaaccctttgaacaatcgttgtaaccggtggaaccgctgcaggagccgccgtgcgac |
35748191 |
T |
|
| Q |
210 |
gacgacggagagttgaattccagtgattttttatggcgttatcggttctacctggaagaagacgagaaatcgtcgcccatttgtttc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35748190 |
gacgacggagagttgaattccagtgattttttatcgcgttatcggttctacctggaagaagacgagaaatcgtcgcccatttgtttc |
35748104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University