View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19828_high_41 (Length: 269)
Name: NF19828_high_41
Description: NF19828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19828_high_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 87 - 260
Target Start/End: Original strand, 3462851 - 3463027
Alignment:
| Q |
87 |
gaatgggaaatgggagttatggagttatatttatgcgtgtgtgaagagacaagaccattgacttttcttcgatttatgggtacgttttcatagccatag- |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
3462851 |
gaatgggaaatgggagttatggagttatatttatgcgtgtgtgaagagacaagaccattgacttttcttcgatttatgtgtacgttttcatagtcatagg |
3462950 |
T |
|
| Q |
186 |
--gtattggattacgatagcggtggaatttatttcacttttccagaaacagtaatggccgcgttttattttcatatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3462951 |
tagtattggattacgatagcggtggaatttatttcacttttccagaaacagtaatggccgcgttttattttcatatt |
3463027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 209 - 260
Target Start/End: Original strand, 4037628 - 4037679
Alignment:
| Q |
209 |
aatttatttcacttttccagaaacagtaatggccgcgttttattttcatatt |
260 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4037628 |
aatttacttcacttttccagaaacagtaatggccgcgttttattttcatatt |
4037679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University